Epigentek Slc46A3

Lab Reagents

Epigentec Antibodies Laboratories manufactures the epigentek slc46a3 reagents distributed by Genprice. The Epigentek Slc46A3 reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact Epigentec Antibodies. Other Epigentek products are available in stock. Specificity: Epigentek Category: Slc46A3

Test Assays information

SLC46A3 Antibody (HRP)

20-abx308363
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

SLC46A3 Antibody (FITC)

20-abx308364
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

SLC46A3 Antibody (Biotin)

20-abx308365
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

SLC46A3 Blocking Peptide

33R-6144 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SLC46A3 antibody, catalog no. 70R-1855

SLC46A3 cloning plasmid

CSB-CL773784HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1392
  • Sequence: atgaagattttatttgtagaacctgccattttccttagtgcatttgctatgactttgaccggtccactgacaacgcaatatgtttatcggagaatatgggaagaaactggcaactacactttttcatctgatagcaatatttctgagtgtgaaaaaaacaaaagcagcccaattt
  • Show more
Description: A cloning plasmid for the SLC46A3 gene.

Mouse SLC46A3 shRNA Plasmid

20-abx977467
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat SLC46A3 shRNA Plasmid

20-abx988315
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human SLC46A3 shRNA Plasmid

20-abx966913
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

SLC46A3 Antibody, HRP conjugated

1-CSB-PA773784LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SLC46A3. Recognizes SLC46A3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

SLC46A3 Antibody, FITC conjugated

1-CSB-PA773784LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SLC46A3. Recognizes SLC46A3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

SLC46A3 Antibody, Biotin conjugated

1-CSB-PA773784LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SLC46A3. Recognizes SLC46A3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

SLC46A3 Recombinant Protein (Human)

RP029191 100 ug Ask for price

SLC46A3 Recombinant Protein (Rat)

RP229649 100 ug Ask for price

SLC46A3 Recombinant Protein (Mouse)

RP173258 100 ug Ask for price

Slc46a3 ORF Vector (Mouse) (pORF)

ORF057754 1.0 ug DNA
EUR 506

SLC46A3 ORF Vector (Human) (pORF)

ORF009731 1.0 ug DNA
EUR 95

Slc46a3 ORF Vector (Rat) (pORF)

ORF076551 1.0 ug DNA
EUR 506