Lab Reagents

Epigentec Antibodies Laboratories manufactures the epigentek slc46a3 reagents distributed by Genprice. The Epigentek Slc46A3 reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact Epigentec Antibodies. Other Epigentek products are available in stock. Specificity: Epigentek Category: Slc46A3

Test Assays information

SLC46A3 Blocking Peptide
33R-6144	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SLC46A3 antibody, catalog no. 70R-1855

SLC46A3 Antibody (HRP)
20-abx308363	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

SLC46A3 Antibody (FITC)
20-abx308364	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

SLC46A3 Antibody (Biotin)
20-abx308365	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

SLC46A3 cloning plasmid
CSB-CL773784HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1392 Sequence: atgaagattttatttgtagaacctgccattttccttagtgcatttgctatgactttgaccggtccactgacaacgcaatatgtttatcggagaatatgggaagaaactggcaactacactttttcatctgatagcaatatttctgagtgtgaaaaaaacaaaagcagcccaattt Show more
Description: A cloning plasmid for the SLC46A3 gene.

SLC46A3 Antibody, HRP conjugated
1-CSB-PA773784LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SLC46A3. Recognizes SLC46A3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

SLC46A3 Antibody, FITC conjugated
1-CSB-PA773784LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SLC46A3. Recognizes SLC46A3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

SLC46A3 Antibody, Biotin conjugated
1-CSB-PA773784LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SLC46A3. Recognizes SLC46A3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Rat SLC46A3 shRNA Plasmid
20-abx988315	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse SLC46A3 shRNA Plasmid
20-abx977467	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human SLC46A3 shRNA Plasmid
20-abx966913	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

SLC46A3 Recombinant Protein (Human)
RP029191	ABM	100 ug	Ask for price

SLC46A3 Recombinant Protein (Rat)
RP229649	ABM	100 ug	Ask for price

SLC46A3 Recombinant Protein (Mouse)
RP173258	ABM	100 ug	Ask for price

Slc46a3 ORF Vector (Rat) (pORF)
ORF076551	ABM	1.0 ug DNA	EUR 506

SLC46A3 ORF Vector (Human) (pORF)
ORF009731	ABM	1.0 ug DNA	EUR 95

Slc46a3 ORF Vector (Mouse) (pORF)
ORF057754	ABM	1.0 ug DNA	EUR 506