Elabscience Lef1

Lab Reagents

Elabscience Laboratories manufactures the elabscience lef1 reagents distributed by Genprice. The Elabscience Lef1 reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact Elabscience. Other Elabscience products are available in stock. Specificity: Elabscience Category: Lef1

Test Assays information

LEF1 Antibody

ABD7570 100 ug
EUR 438

LEF1 Antibody

ABD7580 100 ug
EUR 438

anti-LEF1

YF-PA18905 50 ul
EUR 363
Description: Mouse polyclonal to LEF1

LEF1 Rabbit pAb

A0909-100ul 100 ul
EUR 308

LEF1 Rabbit pAb

A0909-200ul 200 ul
EUR 459

LEF1 Rabbit pAb

A0909-20ul 20 ul
EUR 183

LEF1 Rabbit pAb

A0909-50ul 50 ul
EUR 223

LEF1 Blocking Peptide

DF7570-BP 1mg
EUR 195

LEF1 antibody (Ser42)

70R-35964 100 ug
EUR 327
Description: Rabbit polyclonal LEF1 antibody (Ser42)

Anti-LEF1 Antibody

A00605 100ug/200ul
EUR 397
Description: Goat Polyclonal LEF1 Antibody. Validated in WB and tested in Human, Mouse, Rat.

LEF1 Conjugated Antibody

C35801 100ul
EUR 397

LEF1 cloning plasmid

CSB-CL012856HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1200
  • Sequence: atgccccaactctccggaggaggtggcggcggcgggggggacccggaactctgcgccacggacgagatgatccccttcaaggacgagggcgatcctcagaaggaaaagatcttcgccgagatcagtcatcccgaagaggaaggcgatttagctgacatcaagtcttccttggtga
  • Show more
Description: A cloning plasmid for the LEF1 gene.

LEF1 Rabbit mAb

A4473-100ul 100 ul
EUR 410

LEF1 Rabbit mAb

A4473-200ul 200 ul
EUR 571

LEF1 Rabbit mAb

A4473-20ul 20 ul
EUR 221

LEF1 Rabbit mAb

A4473-50ul 50 ul
EUR 287

anti- LEF1 antibody

FNab04745 100µg
EUR 505.25
  • Immunogen: lymphoid enhancer-binding factor 1
  • Uniprot ID: Q9UJU2
  • Gene ID: 51176
  • Research Area: Epigenetics, Cancer, Metabolism, Developmental biology
Description: Antibody raised against LEF1